Angiebiominds’s Weblog

Just another WordPress.com weblog

Research Proposal

Introduction:

Matrix Metalloproteinases (MMPs) constitute a family of extracellular enzymes that are classified as endopeptidases based on their catalytic mechanism and inhibitor sensitivities (Sternlicht and Werb, 2001). Those proteins are characterized by their potent ability to degrade structural proteins of the extracellular matrix. MMPs are Zn2+ and Ca2+ dependent proteases because they require the binding of these metals in their active site for proper functioning. Also, they are classified in five groups: collagenases, gelatinases, stromelysin, membrane type MMPs and thMMP-20 (Mott and Werb, 2004; Bhuvarahamurthy et al., 2006) based on the substrate specificity of the MMP and the cellular localization of the MMP.The MMPs function in biological process in prokariotic and eukariotic cells (Moreno et al., 2006). Specifically, MMPs function in physiological and pathological processes such as embrionic development, wound healing, matrix degradation, cancer, inflammatory diseases, and ocular diseases. (Lluri and Jaworski, 2005). This semester we focus our work on the study of Collagenase (MMP-1) and Gelatinase (MMP-2), based in the fact that those type of MMP is most related to vision and ocular diseases including retinal disease, glaucoma, corneal disorders, and cataractous lens. The Collagenases includes MMP -1, -8 and -13. This group is capable of degrading fibrillar collagens (mayor components of bone and cartilage) in the extracellular matrix. In order to carry out bioinformatic analyses of the MMPs protein sequences we used the genes of Rhesus Macaca Mulatta. This species of Rhesus monkey was selected to study the MMP genes because this primate is an ideal model organism with advantages such as a completely sequenced genome that shares approximately 93% of its genome with human beings. MMP protein sequences were extracted using the Internet database NCBI and a multiple sequence alignment (MSA) was performed to determine the conserved regions. Based on the conserved regions primers combinations were designed to obtain amplified products of MMPs. The importance of our work resides in the research relevance to obtain new information that will help us to explain how collagenase MMPs work, how they are controlled, and how they influence basic biology. Also, this work is a way to expand our understanding about how these genes regulate many processes of development, homeostasis and diseases and we can analysis the evolutionary divergence process in these genes. Also, we will prepare SELEX evolved aptamers to inhibit cellular MMP function and anlyze the resulting phenotype in cultured cells.

Problems:

* How are Collagenase (MMP-1) and Gelatinase (MMP-2) conserved in primate evolution?

* What is the phenotype in cultured cells after inhibition of MMP-1, -2 function?

Hypothesis:

* The collagenase and gelatinase gene family is highly conserved in primates. PCR primers can be designed base upon this conservation. Primate MMP PCR amplified products can be cloned and sequenced.

* Aptamer inhibition of MMP-1, -2 function will be reveal defined phenotype such as the inhibition of cellular adhesion and related processes.

Methodology:

MMP Sequence Extraction

The protein sequences of: Collagenase and Gelatinase MMPs in Rhesus, Primates and Mammals, the MMPs in Rhesus and MMP-1 in Rhesus were obtained from the Internet Database of the National Center for Biotechnology Information (NCBI).

BLAST

The Basic Local Alignment Search Tool (BLAST) was used to identify regions of local similarity between MMP sequences from Rhesus (MMP-1,    -2 and MMPs), Primates and Mammals.

Multiple Sequence Alignments (MSA)The protein sequences extracted for the Collagenase and Gelatinase MMPs in Rhesus, Primates and Mammals, the MMPs in Rhesus and the MMP-1 in Rhesus were aligned using the Internet program Clustal W.

Annotate the Intron-Exon boundaries of Rhesus M. mulatta MMP-1 geneThe MMP-1 and MMP-2 mRNA and amino acid sequences were superimposed to make the annotated sequence. The exons and introns were identified to determine the distance between the conserved regions.

Primer Design

Primers were designed based on the similarity between the conserved regions identified in the annotated MMP-1 and MMP-2 sequences. The melting temperatures and the sizes of the regions were used to determine matching primer sequences.

Assay Purified MMP-1 and MMP-2  and Aptamer Amplification

MMP function will be inhibited using SELEX designed aptamers, evolved functional oligonucleotides, to determine the corresponding phenotype in cultured cells.

Preliminary Results:

Primer Design

Based on the Codon Usage Database for Rhesus Macaca mulattaPrimers in 5’ to 3’ Orientation

Reverse Translation of Conserved Regions

I. Conserved Regions in MMP Colagenase in Rhesus Alignment:

1. PRCGVPD: cccaggugcggcgugcccgac

2. GGDAHFD: ggcggcgacgcccacuucgac

3. HEfGHSLGL: cacgaguucggccacucccugggccug

II. Conserved Regions in MMP Colagenase in Mammals Alignment:

1. LLLLLF: cugcugcugcugcuguuc

2. RCGVPD: aggugcggcgugcccgac

3. LYRVAA: cuguacaggguggccgcc

4. GNLAHA: ggcaaccuggcccacgcc

III. Conserved Regions in MMP Colagenase in Primates Alignment:

1. PRCGVPD: cccaggugcggcgugcccgac

2. ADIMI: gccgacaucaugauc

3. LAHAF: cuggcccacgccuuc

4. GHSLGL: ggccacucccugggccug

IV. Conserved Regions in MMPs in Rhesus Alignment:

1. PRCG: cccaggugcggc

2. LTYRI: cugaccuacaggauc

3. VTPL: gugaccccccug

4. LAHAF: cuggcccacgccuuc

5. PFDG: cccuucgacggc

Preliminary Primer Pairs for PCR Amplification of Rhesus MMP Domains

Primers in 5’ to 3’ Orientation

a) Primer Pair: II.1 – I.1 II.1. LLLLLF: cugcugcugcugcuguuc I.1. PRCGVPD: cccaggugcggcgugcccgacReverse Complement: I.1. PRCGVPD: gtcgggcacgccgcacctggg

b) Primer Pair: I.2 – II.4 I.2. GGDAHFD: ggcggcgacgcccacuucgac II.4. GNLAHA: ggcaaccuggcccacgccReverse Complement: II.4. GNLAHA: ggcgtgggccaggttgcc

c) Primer Pair: II.4 – II.3 II.4. GNLAHA: ggcaaccuggcccacgcc II.3. LYRVAA: cuguacaggguggccgccReverse Complement: II.3. LYRVAA: ggcggccaccctgtacag

d) Primer Pair: IV.2 – III.2 IV.2. LTYRI: cugaccuacaggauc III.2. ADIMI: gccgacaucaugaucReverse Complement: III.2. ADIMI: gatcatgatgtcggc

No comments yet.

Leave a comment